Marker-based genotyping from FASTQ reads¶
How pathotypr calls lineage-defining SNP markers straight from FASTQ reads: it builds diagnostic k-mers for each marker, screens read k-mers through a Bloom filter and hash index, and aggregates reference/alternate evidence per marker before classifying lineages.
The split-fastq command performs alignment-free genotyping directly from raw FASTQ reads. Given a set of known SNP markers and a reference genome, it builds diagnostic k-mers for each marker and scans reads for evidence of reference vs. alternate alleles.
Architecture¶
Marker TSV + Reference FASTA ──→ Build Diagnostic K-mers ──→ Build Index + Bloom Filter
│
FASTQ Reads ──→ Stream in batches of 8192 ──→ 2-bit encode k-mers ──→ Bloom check ──→ Index lookup
│
Aggregate counts
[ref_count, alt_count]
│
Lineage Classification
Step 1: Diagnostic k-mer construction¶
For each SNP marker at position P with REF allele and ALT allele:
- Extract flanking sequence from the reference genome
- Build two k-mers of length 31 (default):
- REF k-mer: left_flank + REF + right_flank
- ALT k-mer: left_flank + ALT + right_flank
Reference: ...ACTGACTG[C]TAGCTAGC...
↑ SNP position
REF k-mer: ACTGACTG[C]TAGCTAGCGATCGATCGATCG (k=31)
ALT k-mer: ACTGACTG[T]TAGCTAGCGATCGATCGATCG (k=31)
The flanking region is centred on the variant, and the right-flank length is computed separately for the REF and ALT k-mers so that each is exactly k bases even when the alleles differ in length (MNVs).
Indels are intentionally skipped
Indels (insertions/deletions) are intentionally skipped in the FASTQ workflow:
- Short reads spanning repetitive regions (e.g., PE/PPE genes in M. tuberculosis) produce k-mers that match indel signatures at incorrect loci
- This generates false positive variant calls
- Indels are reliably detected only via the FASTA assembly
classifyworkflow, which uses full-length alignment context
Step 2: Hash index + Bloom filter¶
Hash index¶
All diagnostic k-mers are hashed (2-bit encoding, forward + reverse complement) into an FxHashMap<u64, MarkerHitList>:
enum MarkerHitList {
Single((marker_id, is_alt)), // Most common: one marker per k-mer
Multi(Vec<(marker_id, is_alt)>), // Rare: k-mer collision between markers
}
Each marker contributes 4 entries: REF forward, REF revcomp, ALT forward, ALT revcomp.
Bloom filter¶
A 128 KB Bloom filter (2^20 = 1,048,576 bits) acts as a fast pre-check:
- 2 hash functions using multiplicative hashing:
key × c₁ mod BITSandkey × c₂ mod BITS - False positive rate: ~0.004% with ~32K entries and 2 hash functions
- Fits in L2 cache (128 KB vs 512 KB typical L2/core)
Why a Bloom filter?
The Bloom filter rejects ~99.9% of non-marker k-mers in ~2 nanoseconds, before they reach the hash table lookup.
Step 3: FASTQ scanning¶
Batched parallel processing¶
FASTQ file ──→ needletail parser ──→ ReadBatch (contiguous buffer)
│
┌─────┴─────┐
│ rayon │
│ chunks │
└─────┬─────┘
│
Thread-local counts
│
┌─────┴─────┐
│ reduce │
└─────┬─────┘
│
Global counts
-
ReadBatch: A contiguous byte buffer that stores reads back-to-back, avoiding per-read
Vec<u8>allocations. Memory is reused across batches viaclear(). -
Batch size: 8,192 reads per batch. Chosen to amortize rayon scheduling overhead while keeping memory bounded.
-
Chunk size: Each rayon chunk processes
max(64, batch_size / (2 × num_threads))reads with thread-local count arrays. -
Per-read scanning:
- Extract all k-mers (k=31) via
bit_kmers()— no canonical normalization because the index already contains both forward and reverse complement entries - Bloom filter check:
bloom_may_contain(bloom, kmer.0)— rejects ~99.9% of k-mers - Hash table lookup: if in Bloom, check exact match in
FxHashMap -
Increment
counts[marker_id][is_alt] -
Reduction: Thread-local counts are summed into global counts via rayon's
fold + reduce.
Cancellation¶
- Checked every 8,192 records (atomic flag, near-zero overhead)
AtomicBoolshared across threads for fast stop- Parse errors captured via
Arc<Mutex<Option<String>>>with poison recovery
Step 4: Lineage classification¶
The classify_split_fastq module takes the raw [ref_count, alt_count] per marker and determines lineages:
- For each marker, determine the called allele (REF or ALT) based on count ratios
- Walk the hierarchical lineage columns (e.g., L4 → L4.9 → L4.9.1)
- Report the most abundant lineage by default (every ancestor prefix is counted, so this is usually the top level); with
--nested-classification, report the deepest fully supported path
Marker TSV format¶
Reading the lineage columns
Lineage columns are read until the first empty cell. Columns after the empty cell are treated as annotations (gene name, drug resistance, etc.).
Performance¶
Why pathotypr is ~2× faster than fastlin¶
| Factor | pathotypr | fastlin |
|---|---|---|
| K-mer rejection | Bloom filter (2 ns) | Direct hash lookup |
| Read parallelism | rayon batch 8192, chunks per thread | Per-file parallelism |
| Gzip decompression | zlib-ng (SIMD) | miniz_oxide (pure Rust) |
| Memory allocations | Contiguous ReadBatch buffer | Per-read Vec |
Benchmarks (real MTB data)¶
| Sample | pathotypr | fastlin | Speedup |
|---|---|---|---|
| ERR551304 (L2, 158 MB PE) | 1.49 s | 3.23 s | 2.2× |
| ERR552797 (A4, 264 MB PE) | 2.30 s | 4.78 s | 2.1× |
Memory trade-off¶
pathotypr uses ~28 MB vs fastlin's ~3 MB. The difference comes from:
- Full reference genome in memory (4.4 MB for MTB)
- Larger binary (needletail, rayon, indicatif dependencies)
- mimalloc thread arenas (~8 MB)